<< Chapter < Page Chapter >> Page >

List three non-canonical base pairs identified on the web page, besides a G-U wobble base pair.

Got questions? Get instant answers now!

It is clear to see that RNA molecules have many unique characteristics, distinct from the properties of DNA and protein structures. Many of these characteristics can be exploited to predict RNA structure from a nucleotide sequence.

One of the methodologies that is commonly used for RNA structure prediction is based on calculating free energy estimates for each possible fold, then choosing the fold that yields the lowest free energy. These free energy values are a combination of energy values calculated for each pair of adjacent base pairs, plus loop or bulge energies. The energy values are derived from melting studies of synthetically constructed oligoribonucleotides. For more information on the development of RNA free energy parameters, see the Development and References Page of the Zuker-Turner RNA folding package.

Compute the free energy of an RNA structure using the efn server, an RNA free energy web site authored by Michael Zuker, Rensselaer Polytechnic Institute. Copy and paste the following RNA sequence into the sequence query box.

G G C G C G G C A C C G U C C G C G G A A C A A A C G G

Just below the sequence query box, there is a box where the secondary structure can be defined by specifying base pairs. This is done using a triplet of numbers to define each stem region of consecutive base pairs. The first number in the triplet defines the sequence number of the first base in the pair from the 5' end of the sequence. The second number defines the sequence number of the opposing base in the pair. The third number defines how many consecutive bases are involved in the stem. In this example, use the following triplet:

10, 19, 3

The triplet in the above example means that the bases "C C G", number 10, 11 and 12, base pair with the bases "C G G", bases number 17, 18 and 19. Paste the above triplet into the secondary structure box and click on the box that says, "Send data for processing".

What is the computed free energy for this RNA structure?

Got questions? Get instant answers now!

Click on the link that says "png" to get a better picture of the structure. How many bases (non-paired) are in the loop in this structure?

Got questions? Get instant answers now!

Save the png file to disk and send a copy to the course instructor.

Got questions? Get instant answers now!

Now, use the same sequence, but specify a different secondary structure. This time, paste the following triplet into the secondary structure box and send for data processing:

3, 18, 5

What is the computed free energy for this RNA structure?

Got questions? Get instant answers now!

Click on the link that says "png" to get a better picture of the structure. How many bases (non-paired) are in the loop in this structure?

Got questions? Get instant answers now!

Save the png file to disk and send a copy to the course instructor.

Got questions? Get instant answers now!

Which of these two structures is more likely to exist under physiological circumstances, given no additional constraints?

Got questions? Get instant answers now!

A second approach to RNA secondary structure prediction is to look for conserved stem regions in related sequences. This method involves looking for regions within sequences where stems have been conserved, even when the bases have mutated. For this to happen, it would require that if a G mutated to an A, then the opposing C in the base pair would mutate to a U. These regions are found by aligning related RNA sequences, and applying an algorithm that looks for these sorts of paired mutations in predicted stem regions. Align the RNA sequences of the following tRNAs using ClustalW .

>1ASY:S ASPARTYL TRNA SYNTHETASE (ASPRS) UCCGUGAUAGUUXAAXGGXCAGAAUGGGCGCXUGUCXCGUGCCAGAUXGGGGTXCAAUUCCCCGUCGCGGAGCCA>1EIY:C TRNA(PHE) GCCGAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCCGCGGUUCGAUUCCGCGCCUCGGCACCA>1EFW:C ASPARTYL-TRNA GGAGCGGXAGUUCAGXCGGXXAGAAUACCUGCCUXUCXCGCAGGGGXUCGCGGGXXCGAGUCCCGXCCGUUCC>1EHZ:A TRANSFER RNA (PHE) GCGGAUUUAXCUCAGXXGGGAGAGCXCCAGAXUXAAXAXXUGGAGXUCXUGUGXXCGXUCCACAGAAUUCGCACCA

IMPORTANT: After ClustalW alignment, the program puts asterisk below conserved residues. These must be removed before submitting the alignment to the RNA secondary structures prediction server.

Copy the multiple alignment and paste it into the query box at the RNA secondary structure prediction server , Moscow State University. Click "submit query", and the results should appear within about 3 minutes. Scroll down the page and view the section where the stem regions were identified, and their free energies were computed.

How many stems are predicted?

Got questions? Get instant answers now!

List each of their computed free energy values.

Got questions? Get instant answers now!

Continue to scroll down the page and look at the predicted structure diagram. What is the total free energy of the structure?

Got questions? Get instant answers now!

Does this structure that has been predicted from sequences agree well with the known structure of tRNAs?

Got questions? Get instant answers now!

RNA structure has some distinct differences from DNA structure that can be exploited to yield secondary structure predictions that are usually reasonably accurate. In addition, there are many on-line tools and databases that are specific to RNA. Here, the use of a few of these tools has been illustrated, but take some time to view more of the links that are available on the RNA World Website , Institut fur Molekulare Biotechnologie, Jena, Germany.

Questions & Answers

What is scarcity.
Npoanlarb Reply
when there is adequate resources
Fiona
why our wants are limited
Npoanlarb Reply
nooo want is unlimited but resources are limited
Ruchi
and do to that there occurs scarcity and we have to make choice in order to have what we need if need be I will explain more
Madara
our wants are not limited but rather the resources
Moses
as we know that there are two principle of microeconomics scarcity of resources and they have alternative uses...
Ruchi
yes .....
Mathias
because our resources are limited./we have a limited resources.
Ijeoma
what is demand
Thank Reply
demand is something wt we called in economic theory of demand it simply means if price of product is increase then demand of product will decrease
Ruchi
inverse relationship between demand and price
Ruchi
in microeconomic
Ruchi
demand is what and how much you want and what's your need...
Shikhar
how can one be so with economics even while you have less knowledge in mathematics.
OKORO Reply
why is it that some products increases everyday by day
Chiamaka Reply
because demand is increase
Ruchi
because demand is increase
Patience
but how demand increases?
Aziz
Because of the Marketing and purchasing power of people.
AmarbirSingh
but how could we know that people's demands have increased everyday by day and how could we know that this is time to produced the products in the market. Is any connection among them
yaqoob
for normal good people demand remain the same if price of product will increase or not
Ruchi
see that some product which increases day by day is comes under normal good which is used by consumer
Ruchi
Seems hot discussing going here
Shamamet
If there are less products demand starts to increase for those products
Shamamet
Economics is really interesting to learn ....
Shamamet
see there is Inferior goods ands normal goods inferior good demand is rarely increase whereas as we talk about normal good demand will absolutely Increase whether price is increase or not
Ruchi
and demand for normal goods increase cause people's income as a while increases time to time
Abhisek
and it might also be that the cost of raw materials are high.
ATTAH
may be
Ruchi
obviously because demand is increasing.....and price is getting low.....
Shikhar
hmmm there is inverse relationship between demand and price
Ruchi
This is because the supply of those products in relation to raw materials are decreasing and they are also necessities. This crate shortage in the market, so sellers will rise the prices of those products.
Abdul
Importance of economics
Odunayomi Reply
the nature and significance of economics studies
Deborah
What is demand
Shuaib Reply
deman is amount of goods and services a consumer is willing and able to buy or purchase at a given price.
Sainabou
the willingness and ability of a body to purchase goods nd servicesbis called demand ,so if she/has ability but doesn't have willingness it's not a demand same if she or he has willingness but doesn't has ability it's not a demand too
Gul
Demand refers to as quantities of a goods and services in which consumers are willing and able to purchase at a given period of time and demand can also be defined as the desire or willingness and backed by the ability to pay.
Fadiga
Yeah
Mathias
What is Choice
Kofi
Choice refers to the ability of a consumer or producer to decide which good, service or resource to purchase or provide from a range of possible options. Being free to chose is regarded as a fundamental indicator of economic well being and development.
Shonal
choice is a act of selecting or choosing from the numerous or plenty wants.
Fadiga
demand is want and it is also what you need and able to afford a particular period of time... because demand changes with time.
Ijeoma
Demand refers to the ability of the consumer to pay for a particular product at a given price
Abdul
how does consumer make profit
Clifford Reply
by buying goods in bulk.
Ijeoma
Compare and contract the function of commercial bank and the central bank of Nigeria
Akwi Reply
what do think is the difference between overhead costs and prime cost
Abdoulkarim
what is economics
Mohamed Reply
economics is a social science that study's how resources can be used to produce goods and services for society
Nathan
Economic is a science which studies human behavior as a relationship between ends and scares means which have alternatives uses or purposes.
Fadiga
what is economics
Mohamed Reply
what is the basic economic problem
John Reply
rules
Buayadarat_Gaming
unlimited wants vs limited resources
Nathan
what economics is all about?
Nomuhle Reply
what is a new paradigm shift
Austen Reply
Paradigm shift it is the reconcilliation of fedural goods in production
Shyline
fedural? what is that?
Aziz
factors that affecting economic system
Bemen Reply
crux
Shyline
what is meant by broadening the tax base?
Fiona Reply
Difference between extinct and extici spicies
Amanpreet Reply
Got questions? Join the online conversation and get instant answers!
Jobilize.com Reply

Get Jobilize Job Search Mobile App in your pocket Now!

Get it on Google Play Download on the App Store Now




Source:  OpenStax, Bios 533 bioinformatics. OpenStax CNX. Sep 24, 2008 Download for free at http://cnx.org/content/col10152/1.16
Google Play and the Google Play logo are trademarks of Google Inc.

Notification Switch

Would you like to follow the 'Bios 533 bioinformatics' conversation and receive update notifications?

Ask