<< Chapter < Page Chapter >> Page >

List three non-canonical base pairs identified on the web page, besides a G-U wobble base pair.

Got questions? Get instant answers now!

It is clear to see that RNA molecules have many unique characteristics, distinct from the properties of DNA and protein structures. Many of these characteristics can be exploited to predict RNA structure from a nucleotide sequence.

One of the methodologies that is commonly used for RNA structure prediction is based on calculating free energy estimates for each possible fold, then choosing the fold that yields the lowest free energy. These free energy values are a combination of energy values calculated for each pair of adjacent base pairs, plus loop or bulge energies. The energy values are derived from melting studies of synthetically constructed oligoribonucleotides. For more information on the development of RNA free energy parameters, see the Development and References Page of the Zuker-Turner RNA folding package.

Compute the free energy of an RNA structure using the efn server, an RNA free energy web site authored by Michael Zuker, Rensselaer Polytechnic Institute. Copy and paste the following RNA sequence into the sequence query box.

G G C G C G G C A C C G U C C G C G G A A C A A A C G G

Just below the sequence query box, there is a box where the secondary structure can be defined by specifying base pairs. This is done using a triplet of numbers to define each stem region of consecutive base pairs. The first number in the triplet defines the sequence number of the first base in the pair from the 5' end of the sequence. The second number defines the sequence number of the opposing base in the pair. The third number defines how many consecutive bases are involved in the stem. In this example, use the following triplet:

10, 19, 3

The triplet in the above example means that the bases "C C G", number 10, 11 and 12, base pair with the bases "C G G", bases number 17, 18 and 19. Paste the above triplet into the secondary structure box and click on the box that says, "Send data for processing".

What is the computed free energy for this RNA structure?

Got questions? Get instant answers now!

Click on the link that says "png" to get a better picture of the structure. How many bases (non-paired) are in the loop in this structure?

Got questions? Get instant answers now!

Save the png file to disk and send a copy to the course instructor.

Got questions? Get instant answers now!

Now, use the same sequence, but specify a different secondary structure. This time, paste the following triplet into the secondary structure box and send for data processing:

3, 18, 5

What is the computed free energy for this RNA structure?

Got questions? Get instant answers now!

Click on the link that says "png" to get a better picture of the structure. How many bases (non-paired) are in the loop in this structure?

Got questions? Get instant answers now!

Save the png file to disk and send a copy to the course instructor.

Got questions? Get instant answers now!

Which of these two structures is more likely to exist under physiological circumstances, given no additional constraints?

Got questions? Get instant answers now!

A second approach to RNA secondary structure prediction is to look for conserved stem regions in related sequences. This method involves looking for regions within sequences where stems have been conserved, even when the bases have mutated. For this to happen, it would require that if a G mutated to an A, then the opposing C in the base pair would mutate to a U. These regions are found by aligning related RNA sequences, and applying an algorithm that looks for these sorts of paired mutations in predicted stem regions. Align the RNA sequences of the following tRNAs using ClustalW .

>1ASY:S ASPARTYL TRNA SYNTHETASE (ASPRS) UCCGUGAUAGUUXAAXGGXCAGAAUGGGCGCXUGUCXCGUGCCAGAUXGGGGTXCAAUUCCCCGUCGCGGAGCCA>1EIY:C TRNA(PHE) GCCGAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCCGCGGUUCGAUUCCGCGCCUCGGCACCA>1EFW:C ASPARTYL-TRNA GGAGCGGXAGUUCAGXCGGXXAGAAUACCUGCCUXUCXCGCAGGGGXUCGCGGGXXCGAGUCCCGXCCGUUCC>1EHZ:A TRANSFER RNA (PHE) GCGGAUUUAXCUCAGXXGGGAGAGCXCCAGAXUXAAXAXXUGGAGXUCXUGUGXXCGXUCCACAGAAUUCGCACCA

IMPORTANT: After ClustalW alignment, the program puts asterisk below conserved residues. These must be removed before submitting the alignment to the RNA secondary structures prediction server.

Copy the multiple alignment and paste it into the query box at the RNA secondary structure prediction server , Moscow State University. Click "submit query", and the results should appear within about 3 minutes. Scroll down the page and view the section where the stem regions were identified, and their free energies were computed.

How many stems are predicted?

Got questions? Get instant answers now!

List each of their computed free energy values.

Got questions? Get instant answers now!

Continue to scroll down the page and look at the predicted structure diagram. What is the total free energy of the structure?

Got questions? Get instant answers now!

Does this structure that has been predicted from sequences agree well with the known structure of tRNAs?

Got questions? Get instant answers now!

RNA structure has some distinct differences from DNA structure that can be exploited to yield secondary structure predictions that are usually reasonably accurate. In addition, there are many on-line tools and databases that are specific to RNA. Here, the use of a few of these tools has been illustrated, but take some time to view more of the links that are available on the RNA World Website , Institut fur Molekulare Biotechnologie, Jena, Germany.

Questions & Answers

What fields keep nano created devices from performing or assimulating ? Magnetic fields ? Are do they assimilate ?
Stoney Reply
why we need to study biomolecules, molecular biology in nanotechnology?
Adin Reply
?
Kyle
yes I'm doing my masters in nanotechnology, we are being studying all these domains as well..
Adin
why?
Adin
what school?
Kyle
biomolecules are e building blocks of every organics and inorganic materials.
Joe
anyone know any internet site where one can find nanotechnology papers?
Damian Reply
research.net
kanaga
sciencedirect big data base
Ernesto
Introduction about quantum dots in nanotechnology
Praveena Reply
what does nano mean?
Anassong Reply
nano basically means 10^(-9). nanometer is a unit to measure length.
Bharti
do you think it's worthwhile in the long term to study the effects and possibilities of nanotechnology on viral treatment?
Damian Reply
absolutely yes
Daniel
how to know photocatalytic properties of tio2 nanoparticles...what to do now
Akash Reply
it is a goid question and i want to know the answer as well
Maciej
characteristics of micro business
Abigail
for teaching engĺish at school how nano technology help us
Anassong
Do somebody tell me a best nano engineering book for beginners?
s. Reply
there is no specific books for beginners but there is book called principle of nanotechnology
NANO
what is fullerene does it is used to make bukky balls
Devang Reply
are you nano engineer ?
s.
fullerene is a bucky ball aka Carbon 60 molecule. It was name by the architect Fuller. He design the geodesic dome. it resembles a soccer ball.
Tarell
what is the actual application of fullerenes nowadays?
Damian
That is a great question Damian. best way to answer that question is to Google it. there are hundreds of applications for buck minister fullerenes, from medical to aerospace. you can also find plenty of research papers that will give you great detail on the potential applications of fullerenes.
Tarell
what is the Synthesis, properties,and applications of carbon nano chemistry
Abhijith Reply
Mostly, they use nano carbon for electronics and for materials to be strengthened.
Virgil
is Bucky paper clear?
CYNTHIA
carbon nanotubes has various application in fuel cells membrane, current research on cancer drug,and in electronics MEMS and NEMS etc
NANO
so some one know about replacing silicon atom with phosphorous in semiconductors device?
s. Reply
Yeah, it is a pain to say the least. You basically have to heat the substarte up to around 1000 degrees celcius then pass phosphene gas over top of it, which is explosive and toxic by the way, under very low pressure.
Harper
Do you know which machine is used to that process?
s.
how to fabricate graphene ink ?
SUYASH Reply
for screen printed electrodes ?
SUYASH
What is lattice structure?
s. Reply
of graphene you mean?
Ebrahim
or in general
Ebrahim
in general
s.
Graphene has a hexagonal structure
tahir
On having this app for quite a bit time, Haven't realised there's a chat room in it.
Cied
what is biological synthesis of nanoparticles
Sanket Reply
what's the easiest and fastest way to the synthesize AgNP?
Damian Reply
China
Cied
how did you get the value of 2000N.What calculations are needed to arrive at it
Smarajit Reply
Privacy Information Security Software Version 1.1a
Good
Berger describes sociologists as concerned with
Mueller Reply
Got questions? Join the online conversation and get instant answers!
Jobilize.com Reply

Get the best Algebra and trigonometry course in your pocket!





Source:  OpenStax, Bios 533 bioinformatics. OpenStax CNX. Sep 24, 2008 Download for free at http://cnx.org/content/col10152/1.16
Google Play and the Google Play logo are trademarks of Google Inc.

Notification Switch

Would you like to follow the 'Bios 533 bioinformatics' conversation and receive update notifications?

Ask